关键词 > BIOL1951
BIOL1951, Spring 2023, Section 3 Exam 1
发布时间:2023-02-19
Hello, dear friend, you can consult us at any time if you have any questions, add WeChat: daixieit
BIOL1951, Spring 2023, Section 3 (Lane/Mosser)
Exam 1 (90 Points)
Instructions:
1. Make a copy of this document and type in your answers using a program of your choice. Please write in a different color or highlight your answer text. Pay attention to suggested answer lengths, as points will be deducted for overly long answers. When suggested answer lengths are not provided, be concise; points will be deducted for wrong information even if you have the correct answer.
2. Write all answers in your own words. Although collaboration within the class and open use of sources is allowed, your answers must be expressed in your own way. Naturally some answers will be the same or similar, and we will account for this, but you need to have a full understanding of your answers. Students may be asked to meet with instructors to provide explanations for their answers and a point reduction may be imposed if unable to do so.
3. Save your completed document as a .pdf file named in the following way: last name_first initial_Exam1 (example: Schuchardt_A_Exam1.pdf). Upload to the Exam 1 Assignment on Canvas by the due date (Sat, Feb 18, 11:59pm CST). Allow time for possible technical difficulties. If you encounter technical difficulties, immediately email both instructors a copy of your exam. Late submissions will receive a penalty of -5% per hour late.
4. Submitted exams will be checked for originality via the Turnitin webtool. Originality reports (visible to you, instructors, and TAs) will be generated shortly after submitting a document. Documents are checked against web sources and other submitted exams. A base-line level of similarity will be expected, but high similarity to web sources or other student exams is problematic. If you wish to revise and resubmit your exam after viewing the originality report, you may do so up to two times, but any submissions after the due date will receive a late penalty. More information: https://it.umn.edu/services-technologies/how-tos/canvas-students-turnitin-guide
5. This exam is open book and open internet. However, seeking answers or help from someone outside the class via the internet is not permitted (e.g. posting questions to online discussion websites). We will be checking for this.
6. Citing sources: Cite sources you use with URLs for internet sources or a full citation for any printed sources. Our textbook (Brooker, 5th Ed.) does NOT need to be cited. Extensive use of quotes from your sources will result in point deductions, even with citations included. Write in your own words but include citations even when paraphrasing.
In-text citations are not required. A list of sources at the end of each sub-question (e.g. 2B) is sufficient.
7. Collaboration is allowed with other students within our section of Foundations 1 only. Course instructors and TAs may be consulted for clarification but will not provide answers to exam questions nor necessarily answers to past class quizzes or activities. Class time on Friday will be used for optional exam and/or group work.
Statement concerning ethical and professional behavior
By submitting this paper and signing below, I am certifying that:
● I did not consult with any other person outside of our section of Foundations 1 about any aspect of this exam.
● I have listed all of the students with whom I worked on this exam below.
● I have listed all sources I used along with my answers.
● I am unaware of and do not suspect any other student or students of cheating on this exam (e.g. consulting anyone outside of this class section, including use of feedback via websites). If you suspect or know that others have cheated, please contact the instructors.
● The answers I have submitted demonstrate my own understanding of material expressed in my own words. If I were to be asked, I could explain how and why I answered a question in a particular way.
List of students you worked with on this exam: Type the full names of all students you worked with here. If you worked with your full team, you can list your Team number instead of each student.
Type your complete name here, as a signature: type your name here
1. Nature of Science (10 points)
A pseudoscience is a collection of ideas or practices that may appear to be based on the scientific method, but upon closer analysis fail to meet the standards of scientific practice. Choose one of the following web pages about a pseudoscientific topic and then answers the questions:
- The lunar effect: https://www.healthline.com/health/full-moon-effects (Note that this article discusses mental health in some sections. While I find the discussion respectful and interesting, I wanted to give a heads up in case you feel you’d prefer not to be exposed to that material. ~Anna)
- The law of attraction: https://thelawofattraction.com/what-is-the-law-of-attraction/
1A (6 points). How does the topic you chose fit the definition of pseudoscience? How does it appear to be scientific in some way and yet remain largely unscientific? Select two quotes from the web page for your topic: One that illustrates how the topic does meet a characteristic of science and one that illustrates how it fails to meet a different characteristic of science. Consider the list of the characteristics of science we discussed in class. No need to do additional research to answer these questions.
- Science characteristic that is met by your topic:
- Quote from webpage:
- Explanation (1-2 sentences):
- Science characteristic that is not met by your topic:
- Quote from webpage:
- Explanation (1-2 sentences):
1B (4 points). Generate a testable and an untestable hypothesis or prediction about your topic and explain why each is testable or untestable.
- Testable hypothesis/prediction:
- Explanation:
- Untestable hypothesis/prediction:
- Explanation:
2. Biomolecules (25 points)
Cystic fibrosis is an inherited disease that affects the lungs and other organs of the body. Cystic fibrosis is caused by mutations in the gene that encodes for the cystic fibrosis transmembrane receptor (CFTR). CFTR transports chloride ions (Cl- ) across cell membranes. The cystic fibrosis mutations disrupt the structure and the functioning of the CFTR. This disruption results in fewer chloride ions on the surface of cells of the lungs and digestive system and the mucus that lines these organs becomes abnormally thick. The thick mucus increases the risk of infection affects digestion and makes it hard to breathe.
Watch this video that describes the relationship between CFTR functioning and cystic fibrosis:
https://www.youtube.com/watch?v=6IbP1ASGv9w.
Link to iCn3D: (https://www.ncbi.nlm.nih.gov/Structure/icn3d/full.html)
These documents, posted to the Exam 1 Assignment, will help you answer these questions: iCn3D tips and tricks (guide from week 2 inquiry), codon chart, and properties of amino acids
PDB IDs of CFTR channel: (6MSM and 5UAK). If they don’t load when you first try, select “Retrieve by ID” under the “File” tab and then select “PDB ID”.
2A. (5 points) Take a screenshot of the CFTR (5UAK version). Label the following on the diagram (PowerPoint or Google Slides can be a useful way to do this.)
1. Alpha helix
2. Beta sheet
3. N and C termini
4. Indicate which area is located outside the cell (extracellular) and which area is located inside the cell (intracellular)
5. Indicate area encompassed by phospholipid bilayer
Paste the labeled version here:
2B (3 points). CFTR is a chloride ion transmembrane transporter. Why can’t the chloride ion diffuse across the plasma membrane, why does it need a transporter protein? (1-2 sentences)
2C (5 points). How does the structure of CFTR solve the problem of transporting an ionic molecule through a protein that needs to be inserted into the plasma membrane? Make sure your answer includes a description of why there would be a problem as well as how the CFTR structure solves the problem. (Hint: Select “charge” under the “color tab” for both versions of the protein and examine in sphere and ribbon view.) (3-6 sentences)
2D (6 points). Mutation of amino acid 1152, which is located in the chloride ion channel, from aspartic acid to histidine is associated with cystic fibrosis. Based on the structure of the two amino acids and the location of the change in the protein structure, hypothesize why the aspartic acid is important at that location and how/why the change to histidine leads to disease. (3-6 sentences)
2E. (6 points) Mutation of amino acid 126 from glycine to aspartic acid is associated with cystic fibrosis. However, mutation of the amino acid 320 from leucine to valine is not associated with cystic fibrosis. Based on the structure of these amino acids and the location of the changes in the protein structure, explain why the two changes have different impacts on protein functioning.
3. Evolution (25 points)
Read the article “Selection scan reveals three new loci related to high altitude adaptation in Native Andeans” by Jacovas et al. (2008), posted to the Canvas site and available at https://www.nature.com/articles/s41598-018-31100-6. Develop a general understanding of the research in the article but note that there is no need to understand all the biology in the article to answer the following questions. You don’t need to cite this article or our textbook in your answers, but do cite any other sources used.
3A (7 points). Why does this appear to be a case of evolution via natural selection? What specific results in the study show that the elements of natural selection are present? You can use quotes or images from the article, but also write in your own words. Provide clear reasoning and use precise biological terminology. (3-5 sentences)
3B. (4 points). Provide a brief Lamarkian evolutionary explanation for the observed adaptation to high altitudes. (Though we now know this explanation wouldn’t be supported by evidence.) (2-3 sentences)
3D. (6 points). The article points to possible patterns of convergent evolution. What is convergent evolution and how does this article and related research provide an example of it? What additional evidence would you want to collect to determine if this is truly a case of analogy versus homology? (2-4 sentences)
3E. (8 points). Suppose you are discussing this pattern of evolutionary adaptation with a friend who is skeptical about evolutionary theory in general. He responds, “There’s no way that could happen through a random process like evolution. And if this does happen, then why don’t all people living at high altitude have these genes? I just don’t buy it.” What misconceptions about evolution are expressed by your friend (list TWO) and what correct explanations would you provide? Include the reasoning or evidence behind the explanation. (2-3 sentences each)
Misconception and explanation 1 :
Misconception and explanation 2:
4. Gene Expression - Transcription (23 points)
A student working in a lab would like to be able to create spider silk proteins without having to harvest silk from spiders. Spider silk has great potential in many industries including for body armor and for the creation of biodegradable sutures. The student proposes two potential strategies in a presentation to the research group (you) that describes how they would approach each option. However, their slides are incorrect and contain mistakes in depicting structural elements of transcription.
4A (5 points). First, they will put a spider silk (eukaryote) gene into a bacteria (prokaryote). The student shows a slide containing their understanding of transcription in prokaryotes.
For this slide (shown below),
1) identify the single structural error
2) describe the immediate effect of this error on the transcription process
3) assuming transcription can occur, would the prokaryotic cell be able to translate the resulting mRNAs into proteins. Why or why not?
(Note: missing labels and issues with scale of the images are not considered structural errors.)
Identification of error, direct effect of the error, and could translation occur (what and why):
4B (14 points). For the second approach, the student proposes transcribing the mRNAs outside of a cell. Transcription can also occur in a test tube containing a liquid buffer if the right ingredients are provided (a DNA template, RNA polymerase, transcription factors, and nucleotides). The student shares a slide with all the ingredients they will be putting into their test tube. Your task is to examine the drawings of the items that will added to the test tube and based on the information provided,
1) Determine what errors the student is making in the items they will add to the tube
2) Explain how these errors might prevent transcription from occurring and
3) Explain how you would correct these errors.
Identification of errors, impacts on transcription, and how the student could correct these errors. Your explanations should be based on your knowledge of the role of structure and function in gene transcription (2-4 sentences per error).
4C (4 points). Assume that the student corrects these errors and is able to test their strategies. Describe all the differences (if there are any) between the transcription product(s) produced in both the test tube and prokaryotic cell and those that would be produced in a eukaryotic spider cell. Explain either why those differences exist or why there are no differences. (2-4 sentences)
5. Gene Expression - Translation (7 points)
In a fictional scenario, you are trying to develop an mRNA vaccine for the COOTIES virus, which is similar to COVID-19 in structure.
● It has spike proteins on the outside of a large circular virus.
● It is a positive-strand RNA virus, meaning the RNA that serves as its genome also functions as an mRNA.
The original COOTIES vaccine is designed to target the COOTIES’ spike proteins. There are four identified strains of the COOTIES virus: the original strain and three strains with mutations.
Original COOTIES virus genome
mRNA genome section for large circular component
ACGGAAUAUGCGAGCCAGGGUCCUGGCAGCCAGUUGAAGG
mRNA genome section for spike protein
AGCCAGAUGCACACAGAAGCUGUGCAGUGAGCAGGU
5A (6 points). Using your knowledge of translation, proteins, and mRNA vaccines, for each of the three variant strains described below,
1) determine if the mutation in the variant likely requires the development of a new version of the vaccine
2) explain why the mutation likely requires a new version of the vaccine or why it does not require a new version
Mutations in each variant are underlined for easy identification. Also, there are two resources on Canvas including a codon table and properties of amino acids for this question.
Variant 1
mRNA genome section for large circular component
ACGGAAUAUGCGAGCCAGGGUCUUGGCAGCCAGUUGAAGG
mRNA genome section for spike protein
AGCCAGAUGCACACAGAAGCUGUGCAGUGAGCAGGU
Variant 2
mRNA genome section for large circular component
ACGGAAUAUGCGAGCCAGGGUCCUGGCAGCCAGUUGAAGG
mRNA genome section for spike protein
AGCCAGAUGCACAUAGAAGCUGUGCAGUGAGCAGGU
Variant 3
mRNA genome section for large circular component
ACGGAAUAUGCGAGCCAGGGUCCUGGCAGCCAGUUGAAGG
mRNA genome section for spike protein
AGCCAGAUGCACACAGAAGCUGUACAGUGAGCAGGU
5B (1 point) For fun, come up with a disease name that the acronym COOTIES stands for. (Please keep it respectful.)
